MetaPhage Options

These are the parameters supported by the main.nf Nextflow script. Advanced users can invoke the script or modify the configuration file using this reference.

General options

--readPath

Specify the folder where your datasets are stored. Default is $projectDir/dataset. Note that $projectDir correspond to the MetaPhage folder.

--metaPath

Specify the folder where the dataset's metadata are stored. Default is $readPath/metadata/.

--dbPath

Specify the folder where databases are stored. Default is $projectDir/db.

--virome_dataset

(Boolean) Specify if the dataset provided is a virome. This will affect different tools usage. Default is false.

--singleEnd

(Boolean) Specify if your datasets are in single-end mode. Default is false. Please note that single-end mode is not supported yet.

--outdir

Specify the folder where your results are stored. Default is $projectDir/output.

--temp_dir

Specify the folder where your temporary files are stored. Default is $projectDir/temp.

--workDir

Specify the directory where tasks temporary files are created. Default is $projectDir/work.

Quality check and trimming

--skip_qtrimming

(Boolean) Specify whether to perform the quality trimming of your reads or not. Default is false.

--adapter_forward and --adapter_reverse

Specify the adapter sequences. Deafault are AGATCGGAAGAGCACACGTCTGAACTCCAGTCA for forward and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT for reverse.

--mean_quality

Given a read, every base having quality less than --mean_quality (default is 15) is marked as "unqualified". If the percentage of unqualified in the read is more that 40%, that that read if excluded from the analysis. See https://github.com/OpenGene/fastp for more informations.

--trimming_quality

Sliding window trimming is enabled in 5'→3' and in 3'→5' with a window 4bp large. Bases inside the window are trimmed if their mean quality is less then --trimming_quality (default is 15). See https://github.com/OpenGene/fastp for more informations.

--keep_phix

(Boolean) Specify whether to remove the phix or not. Default is false.

--mod_phix

Specify the modality of phix removal. There are 3 possibilities:

• phiX174 (default) search and remove the complete genome of Coliphage phiX174 isolate S1 (GenBank: AF176027.1, https://www.ncbi.nlm.nih.gov/nuccore/AF176027). Genome is automatically downloaded if not already present in ./db/phix/.
• WA11 search and remove the complete genome of Coliphage WA11 (GenBank: DQ079895.1, https://www.ncbi.nlm.nih.gov/nuccore/DQ079895). Genome is automatically downloaded if not already present in ./db/phix/.
• custom search and remove the sequence specified with --file_phix_alone (path to the .fasta file; the path is relative to the pipeline's root directory, for example --file_phix_alone ./db/phix/genome.fasta).

Microbial taxonomy

--skip_bacterial_taxo

(Boolean) Specify whether to skip microbial taxonomy classification step (kraken2 and krona) or not. Default is false.

--skip_kraken2

(Boolean) Specify whether to skip the microbial taxonomy classification with Kraken2 or not. Default is false.

--mod_kraken2

Specify the modality of the short read alignment with Kraken2. There are 3 possibilities:

• miniBAV (default) align against RefSeq bacteria, archaea, and viral libraries. Pre-built database taken from https://ccb.jhu.edu/software/kraken2/downloads.shtml.
• miniBAVH align against RefSeq bacteria, archaea, and viral libraries, and against the GRCh38 human genome. Pre-built database taken from https://ccb.jhu.edu/software/kraken2/downloads.shtml.
• custom align using your custom database. With this modality you have to specify also --file_kraken2_db, which is the path to the folder containing the hash.k2d, opts.k2d and taxo.k2d files. The path is relative to the pipeline's root directory, for example --file_kraken2_db ./db/kraken2/folder/.

--skip_krona

(Boolean) Specify whether to generate the krona-compatible TEXT file using KrakenTools/kreport2krona.py or not. Default is false.

Assembly

--skip_megahit

(Boolean) Specify whether to skip the assembly with MEGAHIT or not. Default is true.

--skip_metaquast

(Boolean) Specify whether to skip the assembly evaluation with metaQUAST or not. Default is false.

Phage mining

--skip_mining

(Boolean) Specify whether to skip the phage mining entire step (VIBRANT, phigaro, VirSorter, VirFinder) or not. Default is false. If you want to exclude a single or multiple tools from this step, use the specific skip parameter instead.

--skip_vibrant

(Boolean) Specify whether to skip the phage mining with VIBRANT or not. Default is false.

--mod_vibrant

Specify the modality of the phage mining with VIBRANT. There are 2 possibilities:

• legacy (default) use VIBRANT 1.0.1.

• standard use VIBRANT 1.2.1. Not working yet (does not produce output).

--skip_phigaro

(Boolean) Specify whether to skip the phage mining with Phigaro or not. Default is false.

--mod_phigaro

Specify the modality of the phage mining with phigaro. There are X possibilities:

• standard (default) use phigaro 2.3.0.

• custom use phigaro using your custom config file. With this modality you have to specify also --file_figaro_config, which is the path to the .yml config file containing yout custom parameters to run the miner.

--skip_virsorter

(Boolean) Specify whether to skip the phage mining with VirSorter or not. Default is false.

--mod_virsorter

Specify the modality of the phage mining with VirSorter. There are 2 possibilities:

• legacy (default) use VirSorter 1.0.6.

• standard use VirSorter 2.0.beta. Not working yet (does not produce output).

• custom use VirSorter with your custom database. With this modality you have to specify also --file_virsorter_db, wich is the path to the folder containing the database file. Please verify that your database files match the required files requested by the VirSorter version (1.0.6).

--skip_virfinder

(Boolean) Specify whether to skip the phage mining with VirFinder or not. Default is false.

Dereplication and reads mapping

--skip_dereplication

(Boolean) Specify whether to skip the dereplication of viral scaffolds or not. Default is false.

--minlen

Specify the minimal length in bp for a viral consensus scaffold. Default is 1000.

Viral taxonomy

--skip_viral_taxo

(Boolean) Specify whether to skip the viral taxonomy classification step (vcontact2, graphanalyzer) or not. Default is false.

--skip_vcontact2

(Boolean) Specify whether to skip the phage taxonomy classification with vcontact2. Default is false.

--mod_vcontact2

Specify the modality of the phage taxonomy analysis with vConTACT2. Currently there are 2 possibilities (new modalities will be added periodically):

• Jan2022 (default) use vConTACT2 with the outputs generated by https://github.com/RyanCook94/inphared.pl script runned on January 2022.
• custom use vConTACT2 using your custom reference genomes and taxonomy. With this modality you have to specify also --file_vcontact2_db, which is the path to the folder containing the vConTACT2_proteins.faa, vConTACT2_gene_to_genome.csv and data_excluding_refseq.tsv files. The path is relative to the pipeline's root directory, for example --file_vcontact2_db ./db/inphared/custom/.

--vcontact2_file_head

Specify the INphared files prefix (vcontact2 db). Default is 20Jan2022_vConTACT2_ If you use a different version of inphared, specify the file prefix string (usually dd/mm/yyyy_vConTACT2_).

--skip_graphanalyzer

(Boolean) Specify wheter to skip the automatic phage taxonomy assignment with graphanalyzer and taxonomy table csv file. Default is false.

Plots and report

--skip_miner_comparison

(Boolean) Specify whether to skip the miner comparison plot (upSet plot) or not. Default is false.

--skip_summary

(Boolean) Specify whether to skip the summary table generation and single (for each sample) violin plots creation or not. Default is false.

--skip_taxonomy_table

(Boolean) Specify whether to skip the taxonomy table generation or not. Default is false.

--skip_heatmap

(Boolean) Specify whether to skip the heatmap plot creation or not. Default is false.

--heatmap_var

Specify the name of the variable (metadata column) to use for the heatmap top dendrogram subdivision. (Requested) in order to generate the heatmap.

--skip_alpha_diversity

(Boolean) Specify whether to skip the alpha-diversity plots creation or not. Default is false.

--alpha_var1

Specify the name of the variable (metadata column) to use for the alpha-diversity sample clustering (on the x-axis). (Requested) in order to generate the alpha-diversity plots

--alpha_var2

Specify the name of the variable (metadata column) to use for the alpha-diversity color mapping. (Requested) in order to generate the alpha-diversity plots.

--skip_beta_diversity

(Boolean) Specify whether to skip the beta-diversity plots creation or not. Default is false.

--beta_var

Specify the name of the variable (metadata column) to use for the beta-diversity color mapping. (Requested) in order to generate the beta-diversity plots.

--skip_violin_plots

(Boolean) Specify whether to skip the violin plot (samples clustered for a variable) or not. Default is false.

--violin_var

Specify the name of the variable (metadata column) to use for the violin plot clustering. (Requested) in order to generate the violin plot.

--skip_report

(Boolean) Specify whether to skip the report step (Multiqc report) or not. Default is false.